CSTminer

Execute CSTminer, the algorithm for the identification of coding and non coding conserved sequence tags through the comparison of two genomic sequences.
Method CSTfinder;
Parameters string seq1, string seq2;
Description Execute CSTminer between two genomic sequences.
(Example: GGGACGCCCGGGCGGCCCTGAAGG - GGTGGATCCTCCAACCCGCTCCCATA)
Perl client ( http://bcc20.caspur.it/BioWStool/makePL.php?dir=Similarity_Searches&ws=C... )
run the client: perl CSTClient.pl method_name file_in file_out
Dependencies: To run the Perl client you need to install SOAP::Lite. SOAP::Lite is a collection of Perl modules which provides a simple and lightweight interface to SOAP both on client and server side.
To get usage information run without arguments:
perl CSTClient.pl
Java client ( http://bcc20.caspur.it/BioWStool/makeJAVA.php?dir=Similarity_Searches&ws... )
run the client: java -jar CSTClient.jar method_name file_in file_out
Dependencies: To run the Java client you need to download these jar zipped files. Include these files in your CLASSPATH variable.
To get usage information run without arguments:
java -jar CSTClient.jar
CSTService
Namespace: http://dl301o22.caspur.it:8080/axis/webservices/Similarity_Searches/CST.jws
Operations
getDescription
- SOAP Action:
- Input Message: getDescriptionRequest
- Output Message: getDescriptionResponse
- getDescriptionReturn
- ArrayOf_xsd_anyType
- getDescriptionReturn
resourcePath
- SOAP Action:
- Input Message: resourcePathRequest
- Output Message: resourcePathResponse
- resourcePathReturn
- string
- resourcePathReturn
getMethodDescription
- SOAP Action:
- Input Message: getMethodDescriptionRequest
- name
- string
- name
- Output Message: getMethodDescriptionResponse
- getMethodDescriptionReturn
- ArrayOf_xsd_anyType
- getMethodDescriptionReturn
getInputDescription
- SOAP Action:
- Input Message: getInputDescriptionRequest
- name
- string
- name
- Output Message: getInputDescriptionResponse
- getInputDescriptionReturn
- ArrayOf_xsd_anyType
- getInputDescriptionReturn
getMethodExample
- SOAP Action:
- Input Message: getMethodExampleRequest
- name
- string
- name
- Output Message: getMethodExampleResponse
- getMethodExampleReturn
- ArrayOf_xsd_anyType
- getMethodExampleReturn
getInputExample
- SOAP Action:
- Input Message: getInputExampleRequest
- name
- string
- name
- Output Message: getInputExampleResponse
- getInputExampleReturn
- ArrayOf_xsd_anyType
- getInputExampleReturn
CSTfinder
- SOAP Action:
- Input Message: CSTfinderRequest
- seq1
- string
- seq2
- string
- seq1
- Output Message: CSTfinderResponse
- CSTfinderReturn
- ArrayOf_xsd_anyType
- CSTfinderReturn
available
- SOAP Action:
- Input Message: availableRequest
- Output Message: availableResponse
- availableReturn
- boolean
- availableReturn
WSDL Changes
| Date | Description of Changes |
| 8th April 2009 | First Snapshot |

Test #1: CSTminer test
This test (written in PERL and called CSTClient.pl) is useful to test the most important method: CSTfinder.
In order to launch the script, it must be installed the package SOAP::Lite.
- Login to post comments